SEARCH · Search NASA

Results for “gene expression analysis”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

SourceResearch connectionFrom yearThrough year

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 469 records · Page 26

All sources NASA NTRS DOE OSTI

DOE OSTI2022

Genome-Wide Study of Hsp90 Gene Family in Cabbage (Brassica oleracea var. capitata L.) and Their Imperative Roles in Response to Cold Stress

Heat shock protein 90 (Hsp90) plays an important role in plant developmental regulation and defensive reactions. Several plant species have been examined for the Hsp90 family gene. However, the Hsp90 gene family in cabbage has not been well investigated to date. In this study, we have been discovered 12 BoHsp90 genes in cabbage ( Brassica oleracea var. capitata L.). These B. oleracea Hsp90 genes were classified into five groups based on phylogenetic analysis. Among the five groups, group one contains five Hsp90 genes, including BoHsp90-1 , BoHsp90-2 , BoHsp90-6 , BoHsp90-10 , and BoHsp90-12 . Group two contains three Hsp90 genes, including BoHsp90-3 , BoHsp90-4 , and BoHsp90 . Group three only includes one Hsp90 gene, including BoHsp90-9 . Group four were consisting of three Hsp90 genes including BoHsp90-5 , BoHsp90-7 , and BoHsp90-8 , and there is no Hsp90 gene from B. oleracea in the fifth group. Synteny analysis showed that a total of 12 BoHsp90 genes have a collinearity relationship with 5 Arabidopsis genes and 10 Brassica rapa genes. The promoter evaluation revealed that the promoters of B. oleracea Hsp90 genes included environmental stress-related and hormone-responsive cis-elements . RNA-seq data analysis indicates that tissue-specific expression of BoHsp90-9 and BoHsp90-5 were highly expressed in stems, leaves, silique, and flowers. Furthermore, the expression pattern of B. oleracea BoHsp90 exhibited that BoHsp90-2, BoHsp90-3, BoHsp90-7, BoHsp90-9, BoHsp90-10, and BoHsp90-11 were induced under cold stress, which indicates these Hsp90 genes perform a vital role in cold acclimation and supports in the continual of normal growth and development process. The cabbage Hsp90 gene family was found to be differentially expressed in response to cold stress, suggesting that these genes play an important role in cabbage growth and development under cold conditions.

Sajad, Shoukat↗

DOE OSTI2021

Protective effect of SIRT6 on cholesterol crystal-induced endothelial dysfunction via regulating ACE2 expression

Highlights: • ACE2 was involved in CC-induced endothelial dysfunction. • SIRT1 and SIRT6 contributed to regulating the protein expression of ACE2 in CC-stimulated endothelial cells. • SIRT6 regulated ACE2 with intranuclear p-ATF2, but not affecting p-ATF2 expression in the cytoplasm. Sirtuins are a family of highly conserved nicotinamide adenine dinucleotide (NAD{sup +})-dependent enzymes. Among the sirtuins, SIRT1 and SIRT6 participate in the regulation of endothelial functions and play significant roles in the physiological and pathological processes of cardiovascular diseases (CVD). Recently, our study found that minute cholesterol crystals (CC) can be endocytosed by endothelial cells and further impair endothelial functions. Since previous studies have reported that angiotensin-converting enzyme (ACE2) involves Angiotensin (Ang) II-induced inflammation in endothelial cells, this study was designed to investigate the role of SIRT1 and SIRT6 in CC-induced variation of ACE2 expression and the related mechanism between SIRT6 and ACE2. We found that ACE2 is involved in CC-induced endothelial dysfunction, which inhibits decreases in nitric oxide (NO) level and endothelial nitric oxide synthase (eNOS) activity and increases in inflammatory factors and adhesion molecules. Besides, SIRT1 and SIRT6 regulated the protein expression of ACE2 in CC-stimulated human umbilical vein endothelial cells (HUVECs). Moreover, bioinformatics analysis from the Enrichr database indicated that activating transcription factor 2 (ATF2), is highly correlated with genes that significantly upregulated after infection with the SIRT6 adenovirus vector. In CC-induced HUVECs, ACE2 expression was up-regulated in cells transfected with ATF2 siRNA. However, further mechanism studies revealed that overexpression of SIRT6 decreases the accumulation of p-ATF2 in the nucleus, but did not affect p-ATF2 expression in the cytoplasm. Taken together, these data indicated that SIRT6 regulates ACE2 might via inhibiting the accumulation of nucleus p-ATF2 in CC-induced endothelial dysfunction.

60 APPLIED LIFE SCIENCES↗

DOE OSTI2020

Comparative Genomic Analysis of Ochratoxin A Biosynthetic Cluster in Producing Fungi: New Evidence of a Cyclase Gene Involvement

The widespread use of Next-Generation Sequencing has opened a new era in the study of biological systems by significantly increasing the catalog of fungal genomes sequences and identifying gene clusters for known secondary metabolites as well as novel cryptic ones. However, most of these clusters still need to be examined in detail to completely understand the pathway steps and the regulation of the biosynthesis of metabolites. Genome sequencing approach led to the identification of the biosynthetic genes cluster of ochratoxin A (OTA) in a number of producing fungal species. Ochratoxin A is a potent pentaketide nephrotoxin produced by Aspergillus and Penicillium species and found as widely contaminant in food, beverages and feed. The increasing availability of several new genome sequences of OTA producer species in JGI Mycocosm and/or GenBank databanks led us to analyze and update the gene cluster structure in 19 Aspergillus and 2 Penicillium OTA producing species, resulting in a well conserved organization of OTA core genes among the species. Furthermore, our comparative genome analyses evidenced the presence of an additional gene, previously undescribed, located between the polyketide and non-ribosomal synthase genes in the cluster of all the species analyzed. The presence of a SnoaL cyclase domain in the sequence of this gene supports its putative role in the polyketide cyclization reaction during the initial steps of the OTA biosynthesis pathway. The phylogenetic analysis showed a clustering of OTA SnoaL domains in accordance with the phylogeny of OTA producing species at species and section levels. The characterization of this new OTA gene, its putative role and its expression evidence in three important representative producing species, are reported here for the first time.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2020

Unraveling the Genetics of Two Key Biomass Traits that Differentiate Upland and Lowland Tetraploid Switchgrass Ecotypes, Colonization by Mycorrhizal Fungi and Frost Tolerance

The overall objectives of the proposal were to dissect the genetics of the ability of switchgrass to interact with arbuscular mycorrhizal fungi (AMF) and to tolerate subzero temperatures, and to investigate the effect of AMF colonization on freezing tolerance and biomass production. In order to achieve this, we generated genetic maps in an F2 mapping population derived from a cross between the lowland genotype AP13 and the upland genotype VS16. In addition to providing a framework for identification of quantitative trait loci (QTL), the genetic maps were used to validate and improve the switchgrass genome assembly. We mapped phenotypic quantitative trait loci (QTL) for AMF colonization and cold tolerance in the F 2 population. We demonstrated that identification of QTL for AMF colonization was achieved only if AMF genus-specific colonization levels were used as phenotypes. No QTL were obtained when the overall level of AMF colonization was used as a trait. We conducted RNASeq on a subset of the F2 progeny following cold acclimation, and developed statistical methods to conduct expression QTL (eQTL) analyses in a polyploid organism. A preliminary analysis of the results identified eQTL for a range of genes that were differentially regulated in the lowland AP13 compared to the upland VS16 under cold acclimation. Once sequencing of the transcriptomes of a temporal replicate of the mapping population that was cold-acclimated using the same conditions has been completed, a final eQTL analysis will be conducted.

09 BIOMASS FUELS↗

NASA NTRSDate not supplied

Gene Expression of Peripheral Blood Mononuclear Cells of Crew Members During Long-Duration Space Missions Indicate Dysregulation of Immunological and Cell Survival Mechanisms

Lymphocytes are naturally exposed to genotoxic stresses. DNA damage occurs during the entire lymphocyte’s life span and is induced mainly by reactive oxygen species (ROS), replication fork collapse, or telomere shortening during the immune response or intense cell proliferation phases. Strong evidence for the influence of immune function on DNA repair comes from studies of SCID disease. SCID mice not only have a deficient V(D)J recombination but are also unable to repair double strand breaks, leading to increased radiation sensitivity. The leukocytes’ transcriptome of 8 ISS crew members revels a dysregulated immune function and activation of cellular survival pathways in response to space environment. We have performed PCR analysis in peripheral mononuclear cells from the same crew members. A list of 62 genes were carefully selected addressing immunological and cell survival pathways. Differentially expressed genes indicated changes in chemokine receptor activity, chemokine binding, toll-like receptors, adhesion molecules and cellular response to DNA damage.

Maria Moreno-Villanueva↗

NASA NTRS2024

Gene Expression of Peripheral Blood Mononuclear Cells of Crew Members During Long-Duration Space Missions Indicate Dysregulation of Immunological and Cell Survival Mechanisms

María Moreno-Villanueva↗

DOE OSTI2021

Deinococcus radiodurans UWO298 Dependence on Background Radiation for Optimal Growth

Ionizing radiation is a major environmental variable for cells on Earth, and so organisms have adapted to either prevent or to repair damages caused by it, primarily from the appearance and accumulation of reactive oxygen species (ROS). In this study, we measured the differential gene expression in Deinococcus radiodurans UWO298 cultures deprived of background ionizing radiation (IR) while growing 605 m underground at the Waste Isolation Pilot Plant (WIPP), reducing the dose rate from 72.1 to 0.9 nGy h –1 from control to treatment, respectively. This reduction in IR dose rate delayed the entry into the exponential phase of the IR-shielded cultures, resulting in a lower biomass accumulation for the duration of the experiment. The RNASeq-based transcriptome analysis showed the differential expression of 0.2 and 2.7% of the D. radiodurans genome after 24 and 34 h of growth in liquid culture, respectively. Gene expression regulation after 34 h was characterized by the downregulation of genes involved in folding newly synthesized and denatured/misfolded proteins, in the assimilation of nitrogen for amino acid synthesis and in the control of copper transport and homeostasis to prevent oxidative stress. We also observed the upregulation of genes coding for proteins with transport and cell wall assembly roles. These results show that D. radiodurans is sensitive to the absence of background levels of ionizing radiation and suggest that its transcriptional response is insufficient to maintain optimal growth.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2025

Model of metabolism and gene expression predicts proteome allocation in Pseudomonas putida

Abstract The genome-scale model of metabolism and gene expression (ME-model) forPseudomonas putidaKT2440,iPpu1676-ME, provides a comprehensive representation of biosynthetic costs and proteome allocation. Compared to a metabolic-only model,iPpu1676-ME significantly expands on gene expression, macromolecular assembly, and cofactor utilization, enabling accurate growth predictions without additional constraints. Multi-omics analysis using RNA sequencing and ribosomal profiling data revealed translational prioritization inP. putida, with core pathways, such as nicotinamide biosynthesis and queuosine metabolism, exhibiting higher translational efficiency, while secondary pathways displayed lower priority. Notably, the ME-model significantly outperformed the M-model in alignment with multi-omics data, thereby validating its predictive capacity. Thus,iPpu1676-ME offers valuable insights intoP. putida’s proteome allocation and presents a powerful tool for understanding resource allocation in this industrially relevant microorganism.

Mathematical & Computational Biology↗

DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗

DOE OSTI2021

raogroupuiuc/rt88_growth

Project: Integrating transcriptomic and metabolomic analysis of the oleaginous yeast Rhodosporidium toruloides IFO0880 during growth under different carbon sources Key points • Gene expression and metabolite concentrations were significantly changed. • Reduced expression of xylulokinase induces a bypass leading to arabitol production. • R. toruloides reprograms its metabolism to allow growth on different substrates.

Deewan, Anshu↗

NASA NTRS2002

Hemichordates and the Origin of Chordates

At the start of the period of the NASA grant three years ago, we had no information on the organization and development of the body axis of the hemichordate, Saccoglossus kowalevskii. Now we have substantial findings about the anteroposterior axis and dorsoventral axis, and based on this information, we have new insights about the origin of chordates from ancestral deuterostomes. We found ways to obtain and preserve large numbers of embryos and hatched juveniles. We can now collect about 40,000 embryos in the month of September, the time of S. kowalevskii spawning at Woods Hole. Excellent cDNA libraries were prepared from three developmental stages. From these libraries, we directly isolated about 30 gene ortholog sequences by screening and pcr techniques, all of these sequences of interest in the inquiry about the animal's organization and development. We also performed a mid-sized EST project (60,000 randomly picked clones, many of these arrayed). About half of these have been analyzed so far by blastx and are suitable for direct use of clones. We have obtained about 50 interesting sequences from this set. The rest still await analysis. Thus, at this time we have isolated orthologs of 80 genes that are known to be expressed in chordates in conserved domains and known to have interesting roles in chordate organization and development. The orthology of the S. kowalevskii sequences has been verified by neighbor joining and parsimony methods, with bootstrap estimates of validity. The S. kowalevskii sequences cluster with other deuterostome sequences, namely, other hemichordates, echinoderms, ascidians, amphioxus, or vertebrates, depending on what sequences are available in the database for comparison. We have used these sequences to do high quality in situ hybridization on S. kowalevskii embryos, and the results can be divided into three sections-those concerning the anteroposterior axis of S. kowalevskii in comparison to the same axis of chordates, those concerning the dorsoventral axis of S. kowalevskii in comparison to the same axis of chordates, and those concerning the signals and transcription factors found in the endoderm, of S. kowalevskii compared to the signals and transcription factors in the endo-mesodermal cells of Spemann's organizer of chordates.

Gerhart, John↗

DOE OSTI2021

Noonan syndrome patient-specific induced cardiomyocyte model carrying SOS1 gene variant c.1654A>G

Noonan syndrome (NS) is a dominant autosomal genetic disorder, associated with mutations in several genes that exhibit multisystem abnormal development including cardiac defects. NS associated with the Son of Sevenless homolog 1 (SOS1) gene mutation attributes to the development of cardiomyopathy and congenital heart defects. Since the treatment option for NS is very limited, an in vitro disease model with SOS1 gene mutation would be beneficial for exploring therapeutic possibilities for NS. We reprogrammed cardiac fibroblasts obtained from a NS patient and normal control skin fibroblasts (C-SF) into induced pluripotent stem cells (iPSCs). We identified NS-iPSCs carry a heterozygous single nucleotide variation in the SOS1 gene at the c.1654A > G. Furthermore, the control and NS-iPSCs were differentiated into induced cardiomyocytes (iCMCs), and the electron microscopic analysis showed that the sarcomeres of the NS-iCMCs were highly disorganized. FACS analysis showed that 47.5% of the NS-iCMCs co-expressed GATA4 and cardiac troponin T proteins, and the mRNA expression levels of many cardiac related genes, studied by qRT-PCR array, were significantly reduced when compared to the control C-iCMCs. We report for the first time that NS-iPSCs carry a single nucleotide variation in the SOS1 gene at the c.1654A>G were showing significantly reduced cardiac genes and proteins expression as well as structurally and functionally compromised when compared to C-iCMCs. These iPSCs and iCMCs can be used as a modeling platform to unravel the pathologic mechanisms and also the development of novel drug for the cardiomyopathy in patients with NS.

60 APPLIED LIFE SCIENCES↗

DOE OSTI2024

Mapping of flumioxazin tolerance in a snap bean diversity panel leads to the discovery of a master genomic region controlling multiple stress resistance genes

Effective weed management tools are crucial for maintaining the profitable production of snap bean (Phaseolus vulgaris L.). Preemergence herbicides help the crop to gain a size advantage over the weeds, but the few preemergence herbicides registered in snap bean have poor waterhemp (Amaranthus tuberculatus) control, a major pest in snap bean production. Waterhemp and other difficult-to-control weeds can be managed by flumioxazin, an herbicide that inhibits protoporphyrinogen oxidase (PPO). However, there is limited knowledge about crop tolerance to this herbicide. We aimed to quantify the degree of snap bean tolerance to flumioxazin and explore the underlying mechanisms. We investigated the genetic basis of herbicide tolerance using genome-wide association mapping approach utilizing field-collected data from a snap bean diversity panel, combined with gene expression data of cultivars with contrasting response. The response to a preemergence application of flumioxazin was measured by assessing plant population density and shoot biomass variables. Snap bean tolerance to flumioxazin is associated with a single genomic location in chromosome 02. Tolerance is influenced by several factors, including those that are indirectly affected by seed size/weight and those that directly impact the herbicide's metabolism and protect the cell from reactive oxygen species-induced damage. Transcriptional profiling and co-expression network analysis identified biological pathways likely involved in flumioxazin tolerance, including oxidoreductase processes and programmed cell death. Transcriptional regulation of genes involved in those processes is possibly orchestrated by a transcription factor located in the region identified in the GWAS analysis. Several entries belonging to the Romano class, including Bush Romano 350, Roma II, and Romano Purpiat presented high levels of tolerance in this study. The alleles identified in the diversity panel that condition snap bean tolerance to flumioxazin shed light on a novel mechanism of herbicide tolerance and can be used in crop improvement.

60 APPLIED LIFE SCIENCES↗

NASA NTRS2015

Transient Gene and miRNA Expression Profile Changes of Confluent Human Fibroblast Cells in Space

Microgravity or an altered gravity environment from the static 1 gravitational constant has been shown to influence global gene expression patterns and protein levels in cultured cells. However, most of the reported studies conducted in space or using simulated microgravity on the ground have focused on the growth or differentiation of the cells. Whether non-dividing cultured cells will sense the presence of microgravity in space has not been specifically addressed. In an experiment conducted on the International Space Station, confluent human fibroblast cells were fixed after being cultured in space for 3 and 14 days for investigations of gene and miRNA (microRNA) expression profile changes in these cells. A fibroblast is a type of cell that synthesizes the extracellular matrix and collagen, the structural framework for tissues, and plays a critical role in wound healing and other functions. Results of the experiment showed that on Day 3, both the flown and ground cells were still proliferating slowly even though they were confluent, as measured by the expression of the protein Ki-67 positive cells, and the cells in space grew slightly faster. Gene and miRNA expression data indicated activation of NF(sub kappa)B (nuclear factor kappa-light-chain-enhancer of activated B cells) and other growth related pathways involving HGF and VEGF in the flown cells. On Day 14 when the cells were mostly non-dividing, the gene and miRNA expression profiles between the flight and ground samples were indistinguishable. Comparison of gene and miRNA expressions in the Day 3 samples in respect to Day 14 revealed that most of the changes observed on Day 3 were related to cell growth for both the flown and ground cells. Analysis of cytoskeleton changes by immunohistochemistry staining of the cells with antibodies for alpha-tubulin showed no difference between the flight and ground samples. Results of our study suggest that in true non-dividing human fibroblast cells, microgravity in space has little effect on the gene and miRNA expression. Gene and miRNA expression changes were observed in cells that were confluent, but still proliferating slowly. The faster growth in the flown cells was associated with the activation of NF(sub kappa)B pathways which triggers the expression of several growth factors and the suppression of the cell cycle checkpoint.

Zhang, Ye↗

NASA NTRS2017

Network Analysis of Rodent Transcriptomes in Spaceflight

Network analysis methods leverage prior knowledge of cellular systems and the statistical and conceptual relationships between analyte measurements to determine gene connectivity. Correlation and conditional metrics are used to infer a network topology and provide a systems-level context for cellular responses. Integration across multiple experimental conditions and omics domains can reveal the regulatory mechanisms that underlie gene expression. GeneLab has assembled rich multi-omic (transcriptomics, proteomics, epigenomics, and epitranscriptomics) datasets for multiple murine tissues from the Rodent Research 1 (RR-1) experiment. RR-1 assesses the impact of 37 days of spaceflight on gene expression across a variety of tissue types, such as adrenal glands, quadriceps, gastrocnemius, tibalius anterior, extensor digitorum longus, soleus, eye, and kidney. Network analysis is particularly useful for RR-1 -omics datasets because it reinforces subtle relationships that may be overlooked in isolated analyses and subdues confounding factors. Our objective is to use network analysis to determine potential target nodes for therapeutic intervention and identify similarities with existing disease models. Multiple network algorithms are used for a higher confidence consensus.

genomics↗

NASA NTRS1996

Promoter-dependent and -independent activation of insulin-like growth factor binding protein-5 gene expression by prostaglandin E2 in primary rat osteoblasts

Insulin-like growth factor (IGF) action is mediated by high affinity cell surface IGF receptors and modulated by a family of secreted IGF binding proteins (IGFBPs). IGFBP-5, the most conserved of six IGFBPs characterized to date, uniquely potentiates the anabolic actions of IGF-I for skeletal cells. In osteoblasts, IGFBP-5 production is stimulated by prostaglandin E2 (PGE2), a local factor that mediates certain effects induced by parathyroid hormone, cytokines such as interleukin-1 and transforming growth factor-beta, and mechanical strain. In this study, we show that transcriptional and post-transcriptional events initiated by PGE2 collaborate to enhance IGFBP-5 gene expression in primary fetal rat osteoblast cultures. PGE2 treatment stimulated up to a 7-fold rise in steady-state levels of IGFBP-5 mRNA throughout 32 h of incubation. Analysis of nascent IGFBP-5 mRNA suggested that PGE2 had only a modest stimulatory effect on IGFBP-5 gene transcription, and transient transfection studies with IGFBP-5 promoter-reporter genes confirmed that PGE2 enhanced promoter activity by approximately 2-fold. Similar stimulatory effects were seen with forskolin. A DNA fragment with only 51 base pairs of the 5'-flanking sequence retained hormonal responsiveness, which may be mediated by a binding site for transcription factor AP-2 located at positions -44 to -36 in the proximal IGFBP-5 promoter. Incubation of osteoblasts with the mRNA transcriptional inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole demonstrated that PGE2 enhanced IGFBP-5 mRNA stability by 2-fold, increasing the t1/2 from 9 to 18 h. The effects of PGE2 on steady-state IGFBP-5 transcripts were abrogated by preincubating cells with cycloheximide, indicating that the effects of PGE2 on both gene transcription and mRNA stability required ongoing protein synthesis. Therefore, both promoter-dependent and -independent pathways converge to enhance IGFBP-5 gene expression in response to PGE2 in osteoblasts.

Non-NASA Center↗

DOE OSTI2023

3′ RNA-seq is superior to standard RNA-seq in cases of sparse data but inferior at identifying toxicity pathways in a model organism

The application of RNA-sequencing has led to numerous breakthroughs related to investigating gene expression levels in complex biological systems. Among these are knowledge of how organisms, such as the vertebrate model organism zebrafish (Danio rerio), respond to toxicant exposure. Recently, the development of 3' RNA-seq has allowed for the determination of gene expression levels with a fraction of the required reads compared to standard RNA-seq. While 3' RNA-seq has many advantages, a comparison to standard RNA-seq has not been performed in the context of whole organism toxicity and sparse data. Here, we examined samples from zebrafish exposed to perfluorobutane sulfonamide (FBSA) with either 3' or standard RNA-seq to determine the advantages of each with regards to the identification of functionally enriched pathways. We found that 3' and standard RNA-seq showed specific advantages when focusing on annotated or unannotated regions of the genome. We also found that standard RNA-seq identified more differentially expressed genes (DEGs), but that this advantage disappeared under conditions of sparse data. We also found that standard RNA-seq had a significant advantage in identifying functionally enriched pathways via analysis of DEG lists but that this advantage was minimal when identifying pathways via gene set enrichment analysis of all genes. These results show that each approach has experimental conditions where they may be advantageous. Our observations can help guide others in the choice of 3' RNA-seq vs standard RNA sequencing to query gene expression levels in a range of biological systems.

3’ RNA-seq↗

DOE OSTI2025

Cyanobacterial circadian regulation enhances bioproduction under subjective nighttime through rewiring of carbon partitioning dynamics, redox balance orchestration, and cell cycle modulation

Abstract Background The industrial feasibility of photosynthetic bioproduction using cyanobacterial platforms remains challenging due to insufficient yields, particularly due to competition between product formation and cellular carbon demands across different temporal phases of growth. This study investigates how circadian clock regulation impacts carbon partitioning between storage, growth, and product synthesis in Synechococcus elongatus PCC 7942, and provides insights that suggest potential strategies for enhanced bioproduction. Results After entrainment to light-dark cycles, PCC 7942 cultures transitioned to constant light revealed distinct temporal patterns in sucrose production, exhibiting three-fold higher productivity during subjective night compared to subjective day despite moderate down-regulation of genes from the photosynthetic apparatus. This enhanced productivity coincided with reduced glycogen accumulation and halted cell division at subjective night time, suggesting temporal separation of competing processes. Transcriptome analysis revealed coordinated circadian clock-driven adjustment of the cell cycle and rewiring of energy and carbon metabolism, with over 300 genes showing differential expression across four time points. The subjective night was characterized by altered expression of cell division-related genes and reduced expression of genes involved in glycogen synthesis, while showing upregulation of glycogen degradation pathways, alternative electron flow components, the pentose phosphate pathway, and oxidative decarboxylation of pyruvate. These molecular changes created favorable conditions for product formation through enhanced availability of major sucrose precursors (glucose-1-phosphate and fructose-6-phosphate) and maintained redox balance through multiple mechanisms. Conclusions Our analysis of circadian regulatory rewiring of carbon metabolism and redox balancing suggests two potential approaches that could be developed for improving cyanobacterial bioproduction: leveraging natural circadian rhythms for optimizing cultivation conditions and timing of pathway induction, and engineering strains that mimic circadian-driven metabolic shifts through controlled carbon flux redistribution and redox rebalancing. While these strategies remain to be tested, they could theoretically improve the efficiency of photosynthetic bioproduction by enabling better temporal separation between cell growth, carbon storage accumulation, and product synthesis phases.

59 BASIC BIOLOGICAL SCIENCES↗