Search NASA⌕ Search

SEARCH · Search NASA

Results for “MAGNETIC SWITCHING”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,297 records · Page 72
All sourcesNASA NTRSDOE OSTI
DOE OSTI2023

Broad Electronic Modulation of Two-Dimensional Metal–Organic Frameworks over Four Distinct Redox States

Two-dimensional (2D) inorganic materials have emerged as exciting platforms for (opto)electronic, thermoelectric, magnetic, and energy storage applications. However, electronic redox tuning of these materials can be difficult. Instead, 2D metal–organic frameworks (MOFs) offer the possibility of electronic tuning through stoichiometric redox changes, with several examples featuring one to two redox events per formula unit. Here, we demonstrate that this principle can be extended over a far greater span with the isolation of four discrete redox states in the 2D MOFs Li x Fe 3 (THT) 2 (x = 0–3, THT = triphenylenehexathiol). This redox modulation results in 10,000-fold greater conductivity, p- to n-type carrier switching, and modulation of antiferromagnetic coupling. Physical characterization suggests that changes in carrier density drive these trends with relatively constant charge transport activation energies and mobilities. Furthermore, this series illustrates that 2D MOFs are uniquely redox flexible, making them an ideal materials platform for tunable and switchable applications.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
NASA NTRS1977

Bubble domain circuit organization

An on-chip bubble domain circuit organization. One or more storage registers are connected to a propagation path whereby data in the form of magnetic bubble domains (bubbles) may be transferred into and out of the storage registers. The propagation path includes a generator for producing the initial bubbles which are expanded into any desired number of new bubbles by a unique multiple output replicator. A unique input decoder is utilized to determine to which storage register the bubbles from the replicator will be directed along the propagation path. Those bubbles not selected may be annihilated. An output decoder utilizing essentially the same decoding scheme as the input decoder, selectively receives bubbles from the storage register. A transfer and replicate switch is utilized between the storage register and output decoder to selectively transfer bubbles to the output decoder. The output decoder may collapse all of the bubbles from certain storage registers so that only the information from the selected storage register reaches the detector. The detectors in turn produce the chip output signal. External control electronics are utilized to control the selective operation of the various devices utilized in the propagation path.

Chen, Thomas T.↗
DOE OSTI2015

Giant Electrocaloric Effect in Ferroelectrics with Tailored Polaw-Nanostructures

Electrocaloric effect (ECE) is the temperature and/or entropy change in a dielectric material caused by an electric field induced polarization change. Although ECE has been studied since 1930s, the very small ECE observed in earlier studies in bulk materials before 2007 makes it not attractive for practical cooling applications. The objectives of this DOE program are to carry out a systematical scientific research on the entropy change and ECE in polar-dielectrics, especially ferroelectrics based on several fundamental hypotheses and to search for answers on a few scientific questions. Especially, this research program developed a series of polar-dielectric materials with controlled nano- and meso-structures and carried out studies on how these structures affect the polar-ordering, correlations, energy landscapes, and consequently the entropy states at different phases and ECE. The key hypotheses of the program include: (i) Whether a large ECE can be obtained near the ferroelectric-paraelectric (FE-PE) transition in properly designed ferroelectrics which possess large polarization P and large ß (the coefficient in the thermodynamic Landau theory where the Gibbs free energy G = G = G 0 + ½ a P 2 +1/4 b P 4 + 1/6 c P 6 – EP, and a = ß (T-T c ), where b,c,ß and Tc are constants)? (ii) What determines/determine ß? Whether a ferroelectric material with built-in disorders, which disrupt the polar-correlations and enabling a large number of local polar-states, such as a properly designed ferroelectric relaxor, can achieve a large ECE? (iii) How to design a ferroelectric material which has flat energy landscape so that the energy barriers for switching among different phases are vanishingly small? What are the necessary conditions to maximize the number of coexisting phases? (iv) How to design ferroelectric materials with a large tunable dielectric response? That is, at zero electric field, the material possesses very low polar-correlation and hence a very small dielectric constant, under the application of electric field, the material develops long range polar-correlation and hence a high dielectric response. Studying and developing these materials will deepen our understanding on the polarization responses in strongly coupled materials and the roles of molecular and nano, meso-, and micro-scale defects and structures on the polarization responses. On the application front, besides ECE, these dielectrics will also have great impact on micro-electronics and communications. (v) The multi-field effect, besides the electric, elastic and even magnetic effects, could be made use of to tune the energy landscape of polar-materials and hence enhance the ECE. Hence the question is what are the suitable material systems to develop and maximize the multi-field effects? (vi) Besides solid dielectric, liquid dielectrics with properly designed molecular structures and dipolar coupling can also exhibit a large ECE near the dipolar order-disorder transition. The study of order-disorder transition and their influence on entropy change and ECE will provide additional avenue to study dielectrics and understand relationship between the polar-ordering and dipolar entropy in dielectrics. (vii) Besides the regular ECE in which applying an electric field will induce dipolar ordering, there are dielectric material systems which can exhibit negative ECE in which the applied field will reduce the dipolar ordering and anomalous ECE in which applying an electric field pulse will generate cooling only. The question is how to control and balance the nano- and meso-scale polar coupling in dielectrics to achieve such effects? ECE in dielectrics provides an interesting and effective avenue to probe the polar-correlation in dielectrics. Thus the study of ECE in polar-dielectrics, besides the application values, will also deepen our understanding of strongly coupled materials systems, phase transitions, and materials systems with nano- and meso-scale disorders. Through the efforts of this DoE program, we have developed understandings for many questions and materials approaches for many hypotheses listed above. The major accomplishments include: (i) The first one to show that a giant ECE can be obtained in bulk materials of ferroelectric P(VDF-TrFE) copolymer, which has a large ß coefficient and high polarization, near FE-PE transition.[1,3,12] (ii) The first who developed the theoretical analyses on the upper bound of dipolar entropy change in polar-materials and the general approach to maximize the coexisting phases with vanishingly small switching fields among the coexisting phases[10,23] Experimental results confirm these theoretical predictions.[24] (iii) The first to show that the relaxor ferroelectrics, due to built-in defects structures at nano- and meso scale, exhibit a giant ECE over a broad temperature range.[1,3,7,14] (iv) The first to show that a large ECE can be obtained near order-disorder transition in dielectric fluids such as liquid crystals with large dielectric anisotropy. Also the study developed a general approach for developing dielectric fluids to achieve a large electric field induced entropy change.[26] (v) We are starting to explore the multi-field effect (multiferroic effect) in nanocomposites in which there exist large dielectric contrasts between the matrix and nanofilelrs and showed that a significantly enhanced ECE compared with polymer matrix.[36] (vi) By facially tuning the nano- and meso-scale dipolar coupling, we are the first to show that an anomalous ECE can be obtained in a relaxor/normal ferroelectric blend.[39] (vii) Introduced and demonstrated that the internal bias field approach can be effective in enhancing the EC response at low electric field. The result is significant since for practical applications, a low applied field is highly desired. (viii) A high sensitivity ECE characterization system has been developed. This program has made major contributions to the advancement of the EC materials and understandings of EC phenomena. To reflect the advancement in the EC materials development and scientific understandings on ECE through in this time period (from Sept. 1, 2007 to May 2015), this final report is written based on the reports complied each year through the program. Some early works on the ECE which were obtained using the indirect method are not included in this report.

36 MATERIALS SCIENCE↗
DOE OSTI2018

Frequency dependent polarisation switching in h-ErMnO 3

We report an electric-field poling study of the geometrically-driven improper ferroelectric h-ErMnO 3 . From a detailed dielectric analysis, we deduce the temperature and the frequency dependent range for which single-crystalline h-ErMnO 3 exhibits purely intrinsic dielectric behaviour, i.e., free from the extrinsic so-called Maxwell-Wagner polarisations that arise, for example, from surface barrier layers. In this regime, ferroelectric hysteresis loops as a function of frequency, temperature, and applied electric fields are measured, revealing the theoretically predicted saturation polarisation on the order of 5–6 μC/cm 2 . Special emphasis is put on frequency dependent polarisation switching, which is explained in terms of domain-wall movement similar to proper ferroelectrics. Controlling the domain walls via electric fields brings us an important step closer to their utilization in domain-wall-based electronics.

36 MATERIALS SCIENCE↗
DOE OSTI2024

Solid State Quantum Refrigeration Superconducting, Absorption and Measurement Based (Final Technical Report)

During this DOE grant, DE-SC0017890, in place for the past six years, all proposed research was carried out and published in peer-reviewed papers, as well as other projects that emerged during the research. In that effort the research team accomplished all proposed research, as well as many closely related research projects discovered and conceived of during the grant. These works included “Efficient Quantum Measurement Engines”, a work published in Physical Review Letters, giving a theory of quantum measurement-based engines, which uses quantum measurement as a resource. These engines are designed to efficiently convert energy from the stochastic quantum measurement process into useful work. Further publications include “Experimental Realization of a Quantum Dot Energy Harvester”, a joint theory and experimental work in collaboration with the group of Charles Smith in Cambridge, UK, as well as long time theoretical collaborators, Rafael Sánchez and Björn Sothmann. This work, featured as an Editor’s Suggestion in Physical Review Letters, realized an earlier theoretical proposal of ours, whereby two resonant tunneling quantum dots are connected to a central electronic cavity that is heated by a hot energy source. We also published “Superconducting Quantum Refrigerator: Breaking and Rejoining Cooper Pairs with Magnetic Field Cycles” a work done in collaboration with experimentalist Francesco Giazotto from ENS Pisa, Italy, which also resulted in a patent. This paper, published in Phys. Rev. Applied, advanced the concept of a cyclic fridge based on the normal/superconducting phase transition together with layered materials separated by tunnel junctions. We also completed the proposed research on a heat transistor, publishing “Thermal transistor and thermometer based on Coulomb-coupled conductors”, carried out as a collaboration between my group and theorists Splettstoesser (Lund U., Sweden), Sothmann (U. Duisburg-Essen, Germany), and Sánchez (U. Autónoma de Madrid, Spain). We carried out an analysis of a quantum coupled to a quantum point contact as a sensitive thermometer and heat transistor. We found the optimal statistical estimator for the temperature and compared it with experiments on the same type of devices. We also investigated autonomous quantum absorption refrigerators using quantum dots to cool by using a very hot thermal reservoir to drive heat between two other reservoirs. In the article “Quantifying the quantum heat contribution from a driven superconducting circuit”, we demonstrated that for a driven superconducting circuit, we showed heat flow provided by a hot source to the qubit can be switched on and off by varying external parameters, the frequency and the intensity of the driving. In the work “Stochastic thermodynamic cycles of a mesoscopic thermoelectric engine”, we reconsidered the autonomous thermoelectric heat engine in terms of underlying cycles. Rather than periodic behavior, the cycles were stochastic in nature. Nevertheless, by undertaking a graph theoretical analysis of the elementary transport processed, great quantitative and qualitative insight could be found. We also considered the quantum measurement process and showed that a quantum version of Maxwell’s demon could be related to the work extraction of a quantum system, closely related to arrow-of-time measures for quantum measurement, as described in our article “Thermodynamics of quantum measurement and Maxwell's demon's arrow of time”. This work was selected in Phys. Rev. A as an Editor’s Suggestion. A recent preprint titled “Cyclic Superconducting Quantum Refrigerators Using Guided Fluxon Propagation” accomplished an important piece of this grant: to propose a new kind of quantum refrigerator using the dynamics of fluxons in a type II superconductor. This invention envisioned a race-track type geometry where fluxons are confined. By applying a gradient of magnetic field together with electric current in a Corbino geometry, the circulating fluxons can actively cool a cold reservoir, realizing a new type of cyclic superconducting refrigerator. We also investigated the possibility of thermal control from different points of view. The application of quantum measurement to the system gives a new kind of control on the system of interest – we have pioneered this approach and shown that measurement can boost the thermal power of quantum engines as described in “Continuous measurement boosted adiabatic quantum thermal machines”. The ability to have heat flows on demand is an outstanding challenge, and we have provided new solutions to this problem in Thermal control across a chain of electronic nanocavities” for a chain of electron cavities using gating voltage control. The control methods using qubit/qubit coupling to create absorption fridges at their most fundamental level have also been developed.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2017

Memristive devices from ZnO nanowire bundles and meshes

Here, we report two types of memristive devices made of ZnO nanowire assemblies and Ag electrodes: nanowire-bundle and nanowire-mesh memristors. Although constructed with the same materials, these devices exhibit different characteristics. Nanowire-bundle memristors have small On/Off ratios and feature stable hysteresis under X-ray irradiation. Nanowire-mesh memristors show large On/Off ratios and multiple distinct states. We attribute the switching in bundle nanowires to the modification of the Schottky barrier by the mobile Ag ions and the stability of hysteresis to the ability of the bundles to retain Ag in the alleys between nanowires, as confirmed by first-principles calculations and energy dispersive x-ray measurements. For nanowire-mesh memristors, the high On/Off ratio leads us to attribute the switching mechanism to the formation and dissolution of Ag bridges in the nano-gaps at the intersections of nanowires.

42 ENGINEERING↗
NASA NTRS1990

The Galileo dust detector

The Galileo Dust Detector is intended to provide direct observations of dust grains with masses between 10(sup -19) kg and 10(sup -9) kg in interplanetary space and in the Jovian system, to investigate their physical and dynamical properties as functions of the distances to the Sun, to Jupiter and to its satellites, to study its interaction with the Galilean satellites and the Jovian magnetosphere. Surface phenomena of the satellites (like albedo variations), which might be effects of meteoroid impacts will be compared with the dust environment. Electric charges of particulate matter in the magnetosphere and its consequences will be studied; e.g. the effects of the magnetic field on the trajectories of dust particles and fragmentation of particles due to electrostatic disruption. The investigation is performed with an instrument that measures the mass, speed, flight direction and electric charge of individual dust particles. It is a multi-coincidence detector with a mass sensitivity 10(sup 6) times higher than that of previous in-situ experiments which measured dust in the outer solar system. The instrument weighs 4.2 kg, consumes 2.4 W, and has a normal data transmission rate of 24 bits/s in nominal spacecraft tracking mode. On December 29, 1989 the instrument was switched-on. After the instrument had been configured to flight conditions cruise science data collection started immediately. In the period to May 18, 1990 at least 168 dust impacts have been recorded. For 81 of these dust grains, masses and impact speeds have been determined. First flux values are also given.

Gruen, E.↗
NASA NTRSDate not supplied

Reflectivity Control Device (RCD) Roll Momentum Management for Solar Cruiser and Beyond

Reflectivity control devices (RCDs), thin film optical devices that are actuated (by application of a voltage across the device) to control the reflection of sunlight on their surfaces, can effectively enable roll momentum management (MM) of a solar sail operating in deep space, outside any magnetic field. This enables solar sails to maintain adequate attitude control in these challenging environments without sacrificing mission life by using expendables. They were planned and developed for use on Solar Cruiser, operating sunward of the Sun-Earth Lagrange Point 1 (sub-L1) in a propulsion-intensive artificial halo orbit. Located in pairs of panels near the distal end of each of four booms, each articulated at a slight angle out of the sail plane to produce a force tangent to the sail at a large moment arm, the RCDs provide roll torque capabilities by using simple switching logic to determine which panels should be activated (voltage applied) to produce torque in the desired direction. The performance capabilities and constraints of these devices across a range of operating conditions, namely sun-relative attitude, is well characterized, granting designers insight on how to properly size the system and optimize the system and component designs to maximize roll torque per unit area. With an informed design, RCDs can be very effective actuators for managing roll momentum with minimal detrimental system impacts (mass, power, complexity, etc.) on Solar Cruiser and other future deep space solar sail missions.

Andrew F Heaton↗
DOE OSTI2019

MagMicro with Ultra-High Energy Resolution (FY19 Q3 Progress Report)

The fabrication of the MMC detector arrays involves two photolithographic procedures. The first is to fabricate the Nb magnetization coil and pick-up coils, the SQUID preamplifiers and the associated wiring. This is done on a full 4” Si wafer, which is subsequently diced into ~0.5 cm2 SQUID chips and ~1 cm2 detector chips. The detector chips are then processed separately by depositing and patterning the paramagnetic Ag:Er sensor and support structures and then electroplating the Au absorber. In Q3, we have successfully completed the full wafer processing for the 32-pixel MMC detector arrays, diced the 4” wafer into the smaller chips and tested the individual components. The coils have the required critical current, the heat switches have a critical temperature in the desired range, and the SQUIDs have the required low noise. Unfortunately, the sputter deposition of the paramagnetic Ag:Er sensor failed several times. We spent considerable time to trace the problem to contaminations of the purifier for the Ar sputtering gas that had been exposed to atmosphere for an extended time during an earlier clean room upgrade. We then determined that the purifier is not essential for high-quality Ag:Er sensor films (Fig. 1), and successfully deposited the Ag:Er sensor film on the ~1 cm 2 detector chip.

42 ENGINEERING↗
NASA NTRS1995

Propagation and damping of broadband upstream whistlers

Previous studies indicated that damping rates of upstream whistlers strongly depend on the details of the electron distribution function. Moreover, detailed analysis of Doppler-shift and whistler dispersion relation indicated that upstream whistlers propagate obliquely in a broad band. In this paper we present results of a kinetic calculation of damping lengths of wide-band whistlers using the sum of 7-drifting bi-Maxwellian electron distributions as a best fit to the International Sun Earth Explorer (ISEE) 1 electron data. For 2 cases, when upstream whistlers are observed, convective damping lengths derived from ISEE magnetic field and ephemeris data are compared with theoretical results. We find that the calculated convective damping lengths are consistent with the data and that upstream whistlers remain marginally stable. We also show that the slope of plasma frame spectra of upstream whistlers, obtained by direct fitting of the observed spectra is between 5 and 7 with a sharp lower frequency cutoff corresponding to a wavelength of about one ion inertial length. When the solar wind velocity is directed largely along the wave normal of the upstream whistlers the polariztion of the right hand waves becomes reversed and low frequencies are switched to high resulting in a peaked spectrum with a strong high frequency cutoff. The overall spectral, wave and particle characteristics, proximity to the shock as well as propagation and damping properties indicate that these waves cannot be generated locally. Instead the observed upstream whistlers arise in the shock ramp most likely by a variety of cross-field drift and/or anisotropy driven instabilities.

Orlowski, D. S.↗
DOE OSTI2014

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2017

Coupled Lattice Polarization and Ferromagnetism in Multiferroic NiTiO 3 Thin Films

Polarization-induced weak ferromagnetism (WFM) was demonstrated a few years back in LiNbO3-type compounds, MTiO3 (M = Fe, Mn, Ni). Although the coexistence of ferroelectric polarization and ferromagnetism has been demonstrated in this rare multiferroic family before, first in bulk FeTiO3, then in thin-film NiTiO3, the coupling of the two order parameters has not been confirmed Here, we report the stabilization of polar, ferromagnetic NiTiO3 by oxide epitaxy on a LiNbO3 substrate utilizing tensile strain and demonstrate the theoretically predicted coupling between its polarization and ferromagnetism by X-ray magnetic circular dichroism under applied fields. The experimentally observed direction of ferroic ordering in the film is supported by simulations using the phase-field approach. Our work validates symmetry-based criteria and first-principles calculations of the coexistence of ferroelectricity and WFM in MTiO3 transition metal titanates crystallizing in the LiNbO3 structure. It also demonstrates the applicability of epitaxial strain as a viable alternative to high-pressure crystal growth to stabilize metastable materials and a valuable tuning parameter to simultaneously control two ferroic order parameters to create a multiferroic. Multiferroic NiTiO3 has potential applications in spintronics where ferroic switching is used, such as new four-stage memories and electromagnetic switches.

36 MATERIALS SCIENCE↗
NASA NTRS1981

Manipulation of Light with Magneto-optic Stripe Domain Films

Magnetic diffraction grating materials, being developed to provide a simple means of deflecting light in a two dimensional, solid state fashion are discussed. The most promising material, for several applications, appears to be bismuth substituted iron garnet films in epitaxial form. Calculations indicate that deflection efficiency greater than 60% is possible in the near infrared region of the spectrum. Within the field of view of the deflector, measurements predict that 105 resolvable spots can be expected. Applications include: (1) general purpose deflection of free laser light, (2) image processing of extended sources such as transparencies, (3) programmable lensing, and (4) fiber optic matrix switching.

Torok, E. J.↗
DOE OSTI2021

Efficiency, Power Loss, and Power Factor Measurement of Quadrupole Magnet Power Supplies at the Spallation Neutron Source

The linear accelerator (LINAC) quadrupole magnets are powered by 42 silicon-controlled rectifier (SCR) based power supplies at the Spallation Neutron Source (SNS) facility of Oak Ridge National Laboratory. These 35V, 525A power supplies are bulky, inefficient and require both air and water cooling. The reliability of the SNS facility is impacted due to water leaks internal to power supplies and current readback issues associated with their unique control system interface, resulting in multiple downtime events. Hence, an alternate solution is necessary for the continued reliable operation of the SNS. To mitigate the above-mentioned problems, this paper proposes the use of off-the-shelf Switch Mode Power Supplies (SMPS) rated for 20V, 500A with serial control interface. These SMPS are air-cooled, more efficient and more compact owing to their switching speeds of approximately 160 kHz. The performance enhancements of the SMPS in comparison with the existing SCR power supply are discussed in detail in this paper. The features of the SMPS, along with experimental results for both power supplies, like efficiency, power losses and stability, are presented. Ongoing work is also discussed.

Harave, Sudarshan↗
DOE OSTI2016

Resistive switching and voltage induced modulation of tunneling magnetoresistance in nanosized perpendicular organic spin valves

Nanoscale multifunctional perpendicular organic spin valves have been fabricated. The devices based on an La{sub 0.7}Sr{sub 0.3}MnO{sub 3}/Alq3/Co trilayer show resistive switching of up to 4-5 orders of magnitude and magnetoresistance as high as -70% the latter even changing sign when voltage pulses are applied. This combination of phenomena is typically observed in multiferroic tunnel junctions where it is attributed to magnetoelectric coupling between a ferromagnet and a ferroelectric material. Modeling indicates that here the switching originates from a modification of the La{sub 0.7}Sr{sub 0.3}MnO{sub 3} surface. This modification influences the tunneling of charge carriers and thus both the electrical resistance and the tunneling magnetoresistance which occurs at pinholes in the organic layer.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
NASA NTRS2011

NASA Tech Briefs, July 2011

Topics covered include: 1) Collaborative Clustering for Sensor Networks; 2) Teleoperated Marsupial Mobile Sensor Platform Pair for Telepresence Insertion Into Challenging Structures; 3) Automated Verification of Spatial Resolution in Remotely Sensed Imagery; 4) Electrical Connector Mechanical Seating Sensor; 5) In Situ Aerosol Detector; 6) Multi-Parameter Aerosol Scattering Sensor; 7) MOSFET Switching Circuit Protects Shape Memory Alloy Actuators; 8) Optimized FPGA Implementation of Multi-Rate FIR Filters Through Thread Decomposition; 9) Circuit for Communication Over Power Lines; 10) High-Efficiency Ka-Band Waveguide Two-Way Asymmetric Power Combiner; 11) 10-100 Gbps Offload NIC for WAN, NLR, and Grid Computing; 12) Pulsed Laser System to Simulate Effects of Cosmic Rays in Semiconductor Devices; 13) Flight Planning in the Cloud; 14) MPS Editor; 15) Object-Oriented Multi Disciplinary Design, Analysis, and Optimization Tool; 16) Cryogenic-Compatible Winchester Connector Mount and Retaining System for Composite Tubes; 17) Development of Position-Sensitive Magnetic Calorimeters for X-Ray Astronomy; 18) Planar Rotary Piezoelectric Motor Using Ultrasonic Horns; 19) Self-Rupturing Hermetic Valve; 20) Explosive Bolt Dual-Initiated from One Side; 21) Dampers for Stationary Labyrinth Seals; 22) Two-Arm Flexible Thermal Strap; 23) Carbon Dioxide Removal via Passive Thermal Approaches; 24) Polymer Electrolyte-Based Ambient Temperature Oxygen Microsensors for Environmental Monitoring; 25) Pressure Shell Approach to Integrated Environmental Protection; 26) Image Quality Indicator for Infrared Inspections; 27) Micro-Slit Collimators for X-Ray/Gamma-Ray Imaging; 28) Scatterometer-Calibrated Stability Verification Method; 29) Test Port for Fiber-Optic-Coupled Laser Altimeter; 30) Phase Retrieval System for Assessing Diamond Turning and Optical Surface Defects; 31) Laser Oscillator Incorporating a Wedged Polarization Rotator and a Porro Prism as Cavity Mirror; 32) Generic, Extensible, Configurable Push-Pull Framework for Large-Scale Science Missions; 33) Dynamic Loads Generation for Multi-Point Vibration Excitation Problems; 34) Optimal Control via Self-Generated Stochasticity; 35) Space-Time Localization of Plasma Turbulence Using Multiple Spacecraft Radio Links; 36) Surface Contact Model for Comets and Asteroids; 37) Dust Mitigation Vehicle; 38) Optical Coating Performance for Heat Reflectors of the JWST-ISIM Electronic Component; 39) SpaceCube Demonstration Platform; 40) Aperture Mask for Unambiguous Parity Determination in Long Wavelength Imagers; 41) Spaceflight Ka-Band High-Rate Radiation-Hard Modulator; 42) Enabling Disabled Persons to Gain Access to Digital Media; 43) Cytometer on a Chip; 44) Principles, Techniques, and Applications of Tissue Microfluidics; and 45) Two-Stage Winch for Kites and Tethered Balloons or Blimps.

Source record↗
DOE OSTI2014

Electro-optic switching in iron oxide nanoparticle embedded paramagnetic chiral liquid crystal via magneto-electric coupling

The variation in optical texture, electro-optic, and dielectric properties of iron oxide nanoparticles (NPs) embedded ferroelectric liquid crystal (FLC) with respect to change in temperature and electrical bias conditions are demonstrated in the current investigations. Improvement in spontaneous polarization and response time in nanocomposites has been attributed to magneto-electric (ME) coupling resulting from the strong interaction among the ferromagnetic nanoparticle's exchange field (due to unpaired e{sup −}) and the field of liquid crystal molecular director. Electron paramagnetic resonance spectrum of FLC material gives a broad resonance signal with superimposed components indicating the presence of a source of spin. This paramagnetic behavior of host FLC material had been a major factor in strengthening the guest host interaction by giving an additional possibility of (a) spin-spin interaction and (b) interactions between magnetic-dipole and electric-dipole moments (ME effects) in the composite materials. Furthermore, the phenomenon of dielectric and static memory effect in these composites are also observed which yet again confirms the coupling of magnetic NP's field with FLC's director orientation. We therefore believe that such advanced soft materials holding the optical and electrical properties of conventional LCs with the magnetic and electronic properties of ferromagnetic nanoparticles are going to play a key role in the development of futuristic multifunctional optical devices.

75 CONDENSED MATTER PHYSICS, SUPERCONDUCTIVITY AND↗
DOE OSTI2016

Low-temperature characterization of Nb-Cu-Nb weak links with Ar ion-cleaned interfaces

We characterize niobium-based lateral Superconductor (S)–Normal metal (N)–Superconductor (SNS) weak links through low-temperature switching current measurements and tunnel spectroscopy. We fabricate the SNS devices in two separate lithography and deposition steps, combined with strong argon ion cleaning before the normal metal deposition in the last step. Our SNS weak link consists of high-quality sputtered Nb electrodes that have contacted with evaporated Cu. The two-step fabrication flow enables more flexibility in the choice of materials and pattern design. A comparison of the temperature-dependent equilibrium critical supercurrent with theoretical predictions indicates that the quality of the Nb-Cu interface is similar to that of evaporated Al-Cu weak links. We further demonstrate a hybrid magnetic flux sensor based on an Nb-Cu-Nb SNS junction, where the phase-dependent normal metal density of states is probed with an Al tunnel junction.

71 CLASSICAL AND QUANTUM MECHANICS, GENERAL PHYSIC↗