Search NASA⌕ Search

SEARCH · Search NASA

Results for “RIBOSIDES”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2012

Tumor Response and Apoptosis of N1-S1 Rodent Hepatomas in Response to Intra-arterial and Intravenous Benzamide Riboside

Purpose: Benzamide riboside (BR) induces tumor apoptosis in multiple cell lines and animals. This pilot study compares apoptosis and tumor response in rat hepatomas treated with hepatic arterial BR (IA) or intravenous (IV) BR. Methods: A total of 10{sup 6} N1-S1 cells were placed in the left hepatic lobes of 15 Sprague-Dawley rats. After 2 weeks, BR (20 mg/kg) was infused IA (n = 5) or IV (n = 5). One animal in each group was excluded for technical factors, which prevented a full dose administration (1 IA and 1 IV). Five rats received saline (3 IA and 2 IV). Animals were killed after 3 weeks. Tumor volumes after IA and IV treatments were analyzed by Wilcoxon rank sum test. The percentage of tumor and normal liver apoptosis was counted by using 10 fields of TUNEL (terminal deoxynucleotidyl transferase dUTP nick-end labeling)-stained slides at 40 Multiplication-Sign magnification. The percentage of apoptosis was compared between IV and IA administrations and with saline sham-treated rats by the Wilcoxon rank sum test. Results: Tumors were smaller after IA treatment, but this did not reach statistical significance (0.14 IA vs. 0.57 IV; P = 0.138). There was much variability in percentage of apoptosis and no significant difference between IA and IV BR (44.49 vs. 1.52%; P = 0.18); IA BR and saline (44.49 vs. 33.83%; P = 0.66); or IV BR and saline (1.52 vs. 193%; P = 0.18). Conclusions: Although differences in tumor volumes did not reach statistical significance, there was a trend toward smaller tumors after IA BR than IV BR in this small pilot study. Comparisons of these treatment methods will require a larger sample size and repeat experimentation.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2011

5-Aminoimidazole-4-Carboxamide Riboside Enhances Effect of Ionizing Radiation in PC3 Prostate Cancer Cells

Purpose: The nucleoside 5-aminoimidazole-4-carboxamide riboside (AICAR) is a low-energy mimetic and adenosine monophosphate (AMP)-activated protein kinase (AMPK) agonist that can affect the phenotype of malignant cells by diminishing their anabolism. It does this by being converted to 5-aminoimidazole-4-carboxamide ribotide (ZMP), an AMP analog. We combined this promising antineoplastic agent with ionizing radiation in an attempt to increase its efficacy. Methods and Materials: The effect of AICAR on cell proliferation, cell viability, apoptosis, reactive oxygen species production, radiosensitivity, and AMPK activation was determined in the human prostate cancer cell line PC3. To elucidate the radiosensitizing mechanism, clonogenic survival assays in the presence of a drug agonist or antagonist or with small interfering RNA targeting AMPK were done, as well as measurements of ZMP production and double strand break repair. Moreover, immunoblot analysis of the radiation response signaling pathways after AICAR treatment was performed. Results: The incubation of human PC3 prostate cancer cells with AICAR-activated AMPK inhibited cell proliferation, decreased viability, increased apoptosis, and generated reactive oxygen species in a dose- and time-dependent manner. None of these endpoints gave more than additive effects when radiation was added. Radiosensitization was observed but only after 72 hours of treatment with 250 {mu}M AICAR, suggesting that it was independent of AMPK activation. This finding was confirmed by small interfering RNA knockdown of AMPK. The mechanism of radiosensitization was associated with imbalanced deoxynucleotide pools owing to ZMP accumulation after AICAR administration that interfered with DNA repair. Conclusions: Our findings on the favorable interaction between low doses of AICAR and ionizing radiation in PC3 cells could open new perspectives for the clinical use of this or similar compounds. However, additional research is still required to establish the ZMP pathway as being of general applicability.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2022

An improved process for the release of synthetic DNA sequences from a solid-phase capture support

Here, to facilitate the solid-phase purification of synthetic DNA sequences, a riboside phosphoramidite, carrying a 5-O-capture linker and a 2-O-silyl ether protecting group, is incorporated into a DNA sequence during its last solid-phase synthesis cycle. After deprotection and release of the DNA sequence from the synthesis support, the sequence is then covalently linked to a capture support to enable the removal of shorter unbound DNA sequences by simply washing these off the support. The solid-phase purified DNA sequence is then released from the capture support, through an innovative intramolecular cyclodeesterification of its terminal riboside ethyl phosphate triester entity and is isolated in a yield of 94% while displaying an exquisite purity of 97%.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2018

Overexpression of NRK1 ameliorates diet- and age-induced hepatic steatosis and insulin resistance

NAD{sup +} is a co-enzyme in redox reactions and a substrate required for activity of various enzyme families, including sirtuins and poly(ADP-ribose) polymerases. Dietary supplementation of NAD{sup +} precursors nicotinamide mononucleotide (NMN) or nicotinamide riboside (NR) protects against metabolic disease, neurodegenerative disorders and age-related physiological decline in mammals. Here we sought to identify the roles of nicotinamide riboside kinase 1 (NRK1) plays in regulating hepatic NAD{sup +} biosynthesis and lipid metabolism. Using adenovirus mediated gene transduction to overexpress or knockdown NRK1 in mouse liver, we have demonstrated that NRK1 is critical for maintaining hepatic NAD{sup +} levels and triglyceride content. We have further shown that the hepatic expression of Nmrk1 mRNA is significantly decreased either in mice treated with high-fat diet or in aged mice. However, adenoviral delivery of NRK1 in these diet- and age-induced mice elevates hepatic NAD{sup +} levels, reduces hepatic steatosis, and improves glucose tolerance and insulin sensitivity. Our results provide important insights in targeting NRK1 for treating hepatic steatosis.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2016

Neutron structures of the Helicobacter pylori 5'-methylthioadenosine nucleosidase highlight proton sharing and protonation states

MTAN (5'-methylthioadenosine nucleosidase) catalyzes the hydrolysis of the N-ribosidic bond of a variety of adenosine-containing metabolites. The Helicobacter pylori MTAN (HpMTAN) hydrolyzes 6-amino-6-deoxyfutalosine in the second step of the alternative menaquinone biosynthetic pathway. Substrate binding of the adenine moiety is mediated almost exclusively by hydrogen bonds, and the proposed catalytic mechanism requires multiple proton-transfer events. Of particular interest is the protonation state of residue D198, which possesses a pKa above 8 and functions as a general acid to initiate the enzymatic reaction. In this study we present three corefined neutron/X-ray crystal structures of wild-type HpMTAN cocrystallized with S-adenosylhomocysteine (SAH), Formycin A (FMA), and (3R,4S)-4-(4-Chlorophenylthiomethyl)-1-[(9-deaza-adenin-9-yl)methyl]-3-hydroxypyrrolidine (p-ClPh-Thio-DADMe-ImmA) as well as one neutron/X-ray crystal structure of an inactive variant (HpMTAN-D198N) cocrystallized with SAH. These results support a mechanism of D198 pKa elevation through the unexpected sharing of a proton with atom N7 of the adenine moiety possessing unconventional hydrogen-bond geometry. Additionally, the neutron structures also highlight active site features that promote the stabilization of the transition state and slight variations in these interactions that result in 100-fold difference in binding affinities between the DADMe-ImmA and ImmA analogs.

37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CH↗
DOE OSTI2010

Recognition of Nucleoside Monophosphate Substrates by Haemophilus influenzae Class C Acid Phosphatase

The e (P4) phosphatase from Haemophilus influenzae functions in a vestigial NAD{sup +} utilization pathway by dephosphorylating nicotinamide mononucleotide to nicotinamide riboside. P4 is also the prototype of class C acid phosphatases (CCAPs), which are nonspecific 5{prime},3{prime}-nucleotidases localized to the bacterial outer membrane. To understand substrate recognition by P4 and other class C phosphatases, we have determined the crystal structures of a substrate-trapping mutant P4 enzyme complexed with nicotinamide mononucleotide, 5{prime}-AMP, 3{prime}-AMP, and 2{prime}-AMP. The structures reveal an anchor-shaped substrate-binding cavity comprising a conserved hydrophobic box that clamps the nucleotide base, a buried phosphoryl binding site, and three solvent-filled pockets that contact the ribose and the hydrogen-bonding edge of the base. The span between the hydrophobic box and the phosphoryl site is optimal for recognizing nucleoside monophosphates, explaining the general preference for this class of substrate. The base makes no hydrogen bonds with the enzyme, consistent with an observed lack of base specificity. Two solvent-filled pockets flanking the ribose are key to the dual recognition of 5{prime}-nucleotides and 3{prime}-nucleotides. These pockets minimize the enzyme's direct interactions with the ribose and provide sufficient space to accommodate 5{prime} substrates in an anti conformation and 3{prime} substrates in a syn conformation. Finally, the structures suggest that class B acid phosphatases and CCAPs share a common strategy for nucleotide recognition.

08 HYDROGEN↗
DOE OSTI2012

Crystal Structures of the Helicobacter pylori MTAN Enzyme Reveal Specific Interactions between S-Adenosylhomocysteine and the 5'-Alkylthio Binding Subsite

The bacterial 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (MTAN) enzyme is a multifunctional enzyme that catalyzes the hydrolysis of the N-ribosidic bond of at least four different adenosine-based metabolites: S-adenosylhomocysteine (SAH), 5'-methylthioadenosine (MTA), 5'-deoxyadenosine (5'-DOA), and 6-amino-6-deoxyfutalosine. These activities place the enzyme at the hub of seven fundamental bacterial metabolic pathways: S-adenosylmethionine (SAM) utilization, polyamine biosynthesis, the purine salvage pathway, the methionine salvage pathway, the SAM radical pathways, autoinducer-2 biosynthesis, and menaquinone biosynthesis. The last pathway makes MTAN essential for Helicobacter pylori viability. Although structures of various bacterial and plant MTANs have been described, the interactions between the homocysteine moiety of SAH and the 5'-alkylthiol binding site of MTAN have never been resolved. We have determined crystal structures of an inactive mutant form of H. pylori MTAN bound to MTA and SAH to 1.63 and 1.20 Å, respectively. The active form of MTAN was also crystallized in the presence of SAH, allowing the determination of the structure of a ternary enzyme–product complex resolved at 1.50 Å. These structures identify interactions between the homocysteine moiety and the 5'-alkylthiol binding site of the enzyme. This information can be leveraged for the development of species-specific MTAN inhibitors that prevent the growth of H. pylori.

Mishra, Vidhi↗
DOE OSTI2015

Recognition of the bacterial alarmone ZMP through long-distance association of two RNA subdomains

The bacterial alarmone 5-aminoimidazole-4-carboxamide riboside 5'-triphosphate (AICAR triphosphate or ZTP), derived from the monophosphorylated purine precursor ZMP, accumulates during folate starvation. ZTP regulates genes involved in purine and folate metabolism through a cognate riboswitch. The linker connecting this riboswitch's two subdomains varies in length by over 100 nucleotides. In this paper, we report the cocrystal structure of the Fusobacterium ulcerans riboswitch bound to ZMP, which spans the two subdomains whose interface also comprises a pseudoknot and ribose zipper. The riboswitch recognizes the carboxamide oxygen of ZMP through an unprecedented inner-sphere coordination with a Mg 2+ ion. We show that the affinity of the riboswitch for ZMP is modulated by the linker length. Notably, ZMP can simultaneously bind to the two subdomains even when they are synthesized as separate RNAs. Finally, the ZTP riboswitch demonstrates how specific small-molecule binding can drive association of distant noncoding-RNA domains to regulate gene expression.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

Arsenolipids in Cultured Picocystis Strain ML and Their Occurrence in Biota and Sediment from Mono Lake, California

Primary production in Mono Lake, a hypersaline soda lake rich in dissolved inorganic arsenic, is dominated by Picocystis strain ML. We set out to determine if this photoautotrophic picoplankter could metabolize inorganic arsenic and in doing so form unusual arsenolipids (e.g., arsenic bound to 2-O-methyl ribosides) as reported in other saline ecosystems and by halophilic algae. We cultivated Picocystis strain ML on a seawater-based medium with either low (37 µM) or high (1000 µM) phosphate in the presence of arsenite (400 µM), arsenate (800 µM), or without arsenic additions (ca 0.025 µM). Cultivars formed a variety of organoarsenic compounds, including a phytyl 2-O-methyl arsenosugar, depending upon the cultivation conditions and arsenic exposure. When the cells were grown at low P, the organoarsenicals they produced when exposed to both arsenite and arsenate were primarily arsenolipids (~88%) with only a modest content of water-soluble organoarsenic compounds (e.g., arsenosugars). When grown at high P, sequestration shifted to primarily water-soluble, simple methylated arsenicals such as dimethylarsinate; arsenolipids still constituted ~32% of organoarsenic incorporated into cells exposed to arsenate but < 1% when exposed to arsenite. Curiously, Picocystis strain ML grown at low P and exposed to arsenate sequestered huge amounts of arsenic into the cells accounting for 13.3% of the dry biomass; cells grown at low P and arsenite exposure sequestered much lower amounts, equivalent to 0.35% of dry biomass. Extraction of a resistant phase with trifluoroacetate recovered most of the sequestered arsenic in the form of arsenate. Uptake of arsenate into low P-cultivated cells was confirmed by X-ray fluorescence, while XANES/EXAFS spectra indicated the sequestered arsenic was retained as an inorganic iron precipitate, similar to scorodite, rather than as an As-containing macromolecule. Samples from Mono Lake demonstrated the presence of a wide variety of organoarsenic compounds, including arsenosugar phospholipids, most prevalent in zooplankton (Artemia) and phytoplankton samples, with much lower amounts detected in the bottom sediments. These observations suggest a trophic transfer of organoarsenicals from the phytoplankton (Picocystis) to the zooplankton (Artemia) community, with efficient bacterial mineralization of any lysis-released organoarsenicals back to inorganic oxyanions before they sink to the sediments.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2010

Estimating Optimal Dose of Twice-Weekly Gemcitabine for Concurrent Chemoradiotherapy in Unresectable Pancreatic Carcinoma: Mature Results of GEMRT-01 Phase I Trial

Purpose: To accurately determine the maximal tolerated dose, feasibility, and antitumor activity of concurrent chemoradiotherapy including twice-weekly gemcitabine in patients with unresectable pancreatic adenocarcinoma. Methods and Materials: Eligible patients with histologically proven adenocarcinoma of the pancreas were included in this Phase I trial. Radiotherapy was delivered to a total dose of 50 Gy. Concurrent chemotherapy with twice-weekly gemcitabine was administered during the 5 weeks of radiotherapy, from an initial dose of 30 mg/m{sup 2}. The gemcitabine doses were escalated in 10-mg/m{sup 2} increments in a three-plus-three design, until dose-limiting toxicities were observed. Results: A total of 35 patients were included in the trial. The feasibility of chemoradiotherapy was high, because all the patients received the planned total radiation dose, and 26 patients (74%) received {>=}70% of the planned chemotherapy dose. The mean total delivered dose of gemcitabine was 417 mg/m{sup 2} (i.e., 77% of the prescribed dose). The maximal tolerated dose of twice-weekly gemcitabine was 70 mg/m{sup 2}. Of the 35 patients, 13 had a partial response (37%) and 21 had stable disease (60%). Overall, the median survival and the 6-, 12-, and 18-month survival rates were 10.6 months and 82%, 31%, and 11%, respectively. Survival was significantly longer in patients with an initial performance status of 0 or 1 (p = .004). Conclusion: Our mature data have indicated that gemcitabine doses can be increased {<=}70 mg/m{sup 2}, when delivered twice-weekly with concurrent radiotherapy. This combination shows promises to achieve better recurrence-free and overall survival. These results will serve as a basis for further implementation of the multimodal treatment of locally advanced pancreatic carcinoma.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2010

Stereotactic Body Radiotherapy and Gemcitabine for Locally Advanced Pancreatic Cancer

Purpose: Patients with nonmetastatic locally advanced unresectable pancreatic cancer have a dismal prognosis. Conventional concurrent chemoradiotherapy requires 6 weeks of daily treatment and can be arduous. We explored the safety and effectiveness of a 3-day course of hypofractionated stereotactic body radiotherapy (SBRT) followed by gemcitabine in this population. Patients and Methods: A total of 36 patients with nonmetastatic, locally advanced, unresectable pancreatic cancer with {>=}12 months of follow-up were included. They received three fractions of 8, 10, or 12 Gy (total dose, 24-36 Gy) of SBRT according to the tumor location in relation to the stomach and duodenum, using fiducial-based respiratory motion tracking on a robotic radiosurgery system. The patients were then offered gemcitabine for 6 months or until tolerance or disease progression. Results: With an overall median follow-up of 24 months (range, 12-33), the local control rate was 78%, the median overall survival time was 14.3 months, the median carbohydrate antigen 19-9-determined progression-free survival time was 7.9 months, and the median computed tomography-determined progression-free survival time was 9.6 months. Of the 36 patients, 28 (78%) eventually developed distant metastases. Six patients (17%) were free of progression at the last follow-up visit (range, 13-30 months) as determined by normalized tumor markers with stable computed tomography findings. Nine Grade 2 (25%) and five Grade 3 (14%) toxicities attributable to SBRT occurred. Conclusion: Hypofractionated SBRT can be delivered quickly and effectively in patients with nonmetastatic, locally advanced, unresectable pancreatic cancer with acceptable side effects and minimal interference with gemcitabine chemotherapy.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2010

The Effects of G2-Phase Enrichment and Checkpoint Abrogation on Low-Dose Hyper-Radiosensitivity

Purpose: An association between low-dose hyper-radiosensitivity (HRS) and the 'early' G2/M checkpoint has been established. An improved molecular understanding of the temporal dynamics of this relationship is needed before clinical translation can be considered. This study was conducted to characterize the dose response of the early G2/M checkpoint and then determine whether low-dose radiation sensitivity could be increased by synchronization or chemical inhibition of the cell cycle. Methods and Materials: Two related cell lines with disparate HRS status were used (MR4 and 3.7 cells). A double-thymidine block technique was developed to enrich the G2-phase population. Clonogenic cell survival, radiation-induced G2-phase cell cycle arrest, and deoxyribonucleic acid double-strand break repair were measured in the presence and absence of inhibitors to G2-phase checkpoint proteins. Results: For MR4 cells, the dose required to overcome the HRS response (approximately 0.2 Gy) corresponded with that needed for the activation of the early G2/M checkpoint. As hypothesized, enriching the number of G2-phase cells in the population resulted in an enhanced HRS response, because a greater proportion of radiation-damaged cells evaded the early G2/M checkpoint and entered mitosis with unrepaired deoxyribonucleic acid double-strand breaks. Likewise, abrogation of the checkpoint by inhibition of Chk1 and Chk2 also increased low-dose radiosensitivity. These effects were not evident in 3.7 cells. Conclusions: The data confirm that HRS is linked to the early G2/M checkpoint through the damage response of G2-phase cells. Low-dose radiosensitivity could be increased by manipulating the transition of radiation-damaged G2-phase cells into mitosis. This provides a rationale for combining low-dose radiation therapy with chemical synchronization techniques to improve increased radiosensitivity.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2011

Preoperative Chemoradiation for Rectal Cancer Using Capecitabine and Celecoxib Correlated With Posttreatment Assessment of Thymidylate Synthase and Thymidine Phosphorylase Expression

Purpose: Thymidylate synthase (TS) and thymidine phosphorylase (TP) expression have been shown to be predictors of response to therapy. The toxicity, efficacy, surgical morbidity, and immunohistochemical TS and TP expression were assessed in surgical resection specimens after preoperative chemoradiation. Methods and Materials: Twenty patients with clinical stage I to III rectal adenocarcinoma received preoperative chemoradiation and underwent surgical resection 6 weeks later. Results: Posttreatment tumor stages were T1 to T2 and N0 in 30% of patients; T3 to T4 and N0 in 30% of patients; and T1 to T3 and N1 to N2 in 15% of patients. Pathologic complete response (pCR) was evident in 25% and tumor regression occurred in a total of 80% of patients. Anal sphincter-sparing surgery was performed in 80% of cases. Acute and perioperative complications were minimal, with no grade 3/4 toxicity or treatment breaks. Pelvic control was obtained in 90% of patients. With a median follow-up of 65.5 months (range, 8-80 months), the 6-year actuarial survival rate was 75%. Local failure was significantly associated with nonresponse to therapy and with high TS and low TP expression (p = 0.008 and p = 0.04, respectively). Conclusions: The combination of capecitabine, celecoxib, and x-radiation therapy yields excellent response: a 25% pathologic pCR, no acute grade 3/4 toxicity, and minimal surgical morbidity. Nonresponders expressed significantly increased TS levels and decreased TP levels in posttreatment resection specimens compared to responders.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2010

Post Treatment With an FGF Chimeric Growth Factor Enhances Epithelial Cell Proliferation to Improve Recovery From Radiation-Induced Intestinal Damage

Purpose: A fibroblast growth factor (FGF) 1-FGF2 chimera (FGFC) was created previously and showed greater structural stability than FGF1. This chimera was capable of stimulating epithelial cell proliferation much more strongly than FGF1 or FGF2 even without heparin. Therefore FGFC was expected to have greater biologic activity in vivo. This study evaluated and compared the protective activity of FGFC and FGF1 against radiation-induced intestinal injuries. Methods and Materials: We administered FGFC and FGF1 intraperitoneally to BALB/c mice 24 h before or after total-body irradiation (TBI). The numbers of surviving crypts were determined 3.5 days after TBI with gamma rays at doses ranging from 8 to 12 Gy. Results: The effect of FGFC was equal to or slightly superior to FGF1 with heparin. However, FGFC was significantly more effective in promoting crypt survival than FGF1 (p < 0.01) when 10 {mu}g of each FGF was administered without heparin before irradiation. In addition, FGFC was significantly more effective at promoting crypt survival (p < 0.05) than FGF1 even when administered without heparin at 24 h after TBI at 10, 11, or 12 Gy. We found that FGFC post treatment significantly promoted 5-bromo-2'-deoxyuridine incorporation into crypts and increased crypt depth, resulting in more epithelial differentiation. However, the number of apoptotic cells in FGFC-treated mice decreased to almost the same level as that in FGF1-treated mice. Conclusions: These findings suggest that FGFC strongly enhanced radioprotection with the induction of epithelial proliferation without exogenous heparin after irradiation and is useful in clinical applications for both the prevention and post treatment of radiation injuries.

63 RADIATION, THERMAL, AND OTHER ENVIRON. POLLUTAN↗
DOE OSTI2011

Dependence of Cell Survival on Iododeoxyuridine Concentration in 35-keV Photon-Activated Auger Electron Radiotherapy

Purpose: To measure and compare Chinese hamster ovary cell survival curves using monochromatic 35-keV photons and 4-MV x-rays as a function of concentration of the radiosensitizer iododeoxyuridine (IUdR). Methods and Materials: IUdR was incorporated into Chinese hamster ovary cell DNA at 16.6 {+-} 1.9%, 12.0 {+-} 1.4%, and 9.2 {+-} 1.3% thymidine replacement. Cells were irradiated from 1 to 8 Gy with 35-keV synchrotron-generated photons and conventional radiotherapy 4-MV x-rays. The effects of the radiation were measured via clonogenic survival assays. Surviving fraction was plotted vs. dose and fit to a linear quadratic model. Sensitization enhancement ratios (SER{sub 10}) were calculated as the ratio of doses required to achieve 10% surviving fraction for cells without and with DNA-incorporated IUdR. Results: At 4 MV, SER{sub 10} values were 2.6 {+-} 0.1, 2.2 {+-} 0.1, and 1.5 {+-} 0.1 for 16.6%, 12.0%, and 9.2% thymidine replacement, respectively. At 35 keV, SER{sub 10} values were 4.1 {+-} 0.2, 3.0 {+-} 0.1, and 2.0 {+-} 0.1, respectively, which yielded SER{sub 10} ratios (35 keV:4 MV) of 1.6 {+-} 0.1, 1.4 {+-} 0.1, and 1.3 {+-} 0.1, respectively. Conclusions: SER{sub 10} increases monotonically with percent thymidine replacement by IUdR for both modalities. As compared to 4-MV x-rays, 35-keV photons produce enhanced SER{sub 10} values whose ratios are linear with percent thymidine replacement and assumed to be due to Auger electrons contributing to enhanced dose to DNA. Although this Auger effectiveness factor is less than the radiosensitization factor of IUdR, both could be important for the clinical efficacy of IUdR radiotherapy.

62 RADIOLOGY AND NUCLEAR MEDICINE↗
DOE OSTI2011

Carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increase affinity of nuclear mono-ubiquitinated annexin A1 for DNA containing 8-oxo-guanosine, and promote translesion DNA synthesis

To elucidate the biological roles of mono-ubiquitinated annexin A1 in nuclei, we investigated the interaction of purified nuclear mono-ubiquitinated annexin A1 with intact and oxidatively damaged DNA. We synthesized the 80mer 5'-GTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTAC GTGAACCA-3' (P0G), and four additional 80mers, each with a selected single G in position 14, 30, 37 or 48 replaced by 8-oxo-guanosine (8-oxo-G) to model DNA damaged at a specific site by oxidation. Nuclear mono-ubiquitinated annexin A1 was able to bind oligonucleotides containing 8-oxo-G at specific positions, and able to anneal damaged oligonucleotide DNA to M13mp18 in the presence of Ca{sup 2+} or heavy metals such as As{sup 3+} and Cr{sup 6+}. M13mp18/8-oxo-G-oligonucleotide duplexes were unwound by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP. The binding affinity of nuclear annexin A1 for ssDNA was higher for oxidatively damaged oligonucleotides than for the undamaged oligonucleotide P0G, whereas the maximal binding was not significantly changed. The carcinogenic heavy metals, As{sup 3+} and Cr{sup 6+}, increased the affinity of mono-ubiquitinated annexin A1 for oxidatively damaged oligonucleotides. Nuclear mono-ubiquitinated annexin A1 stimulated translesion DNA synthesis by Pol {beta}. Nuclear extracts of L5178Y tk(+/-) lymphoma cells also promoted translesion DNA synthesis in the presence of the heavy metals As{sup 3+} and Cr{sup 6+}. This DNA synthesis was inhibited by anti-annexin A1 antibody. These observations do not prove but provide strong evidence for the hypothesis that nuclear mono-ubiquitinated annexin A1 is involved in heavy metal promoted translesion DNA synthesis, thereby exhibiting the capacity to increase the introduction of mutations into DNA.

60 APPLIED LIFE SCIENCES↗
DOE OSTI2011

Characterization of protoberberine analogs employed as novel human P2X{sub 7} receptor antagonists

The P2X{sub 7} receptor (P2X{sub 7}R), a member of the ATP-gated ion channel family, is regarded as a promising target for therapy of immune-related diseases including rheumatoid arthritis and chronic pain. A group of novel protoberberine analogs (compounds 3-5), discovered by screening of chemical libraries, was here investigated with respect to their function as P2X{sub 7}R antagonists. Compounds 3-5 non-competitively inhibited BzATP-induced ethidium ion influx into hP2X{sub 7}-expressing HEK293 cells, with IC{sub 50} values of 100-300 nM. This antagonistic action on the channel further confirmed that both BzATP-induced inward currents and Ca{sup 2+} influx were strongly inhibited by compounds 3-5 in patch-clamp and Ca{sup 2+} influx assays. The antagonists also effectively suppressed downstream signaling of P2X{sub 7} receptors including IL-1{beta} release and phosphorylation of ERK1/2 and p38 proteins in hP2X{sub 7}-expressing HEK293 cells or in differentiated human monocytes (THP-1 cells). Moreover, IL-2 secretion from CD3/CD28-stimulated Jurkat T cell was also dramatically inhibited by the antagonist. These results imply that novel protoberberine analogs may modulate P2X{sub 7} receptor-mediated immune responses by allosteric inhibition of the receptor. - Graphical abstract: Display Omitted

60 APPLIED LIFE SCIENCES↗