Search NASA⌕ Search

SEARCH · Search NASA

Results for “synthetic DNA sequences”

Search indexed NASA NTRS and DOE OSTI research on propulsion, heat transfer, battery materials and energy systems. Follow report and document links to the original sources.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 19 records
All sourcesNASA NTRSDOE OSTI
DOE OSTI2022

An improved process for the release of synthetic DNA sequences from a solid-phase capture support

Here, to facilitate the solid-phase purification of synthetic DNA sequences, a riboside phosphoramidite, carrying a 5-O-capture linker and a 2-O-silyl ether protecting group, is incorporated into a DNA sequence during its last solid-phase synthesis cycle. After deprotection and release of the DNA sequence from the synthesis support, the sequence is then covalently linked to a capture support to enable the removal of shorter unbound DNA sequences by simply washing these off the support. The solid-phase purified DNA sequence is then released from the capture support, through an innovative intramolecular cyclodeesterification of its terminal riboside ethyl phosphate triester entity and is isolated in a yield of 94% while displaying an exquisite purity of 97%.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

Nanopore Readable Activity Probes for Ribosomal Inactivating Protein (RIP) Toxins

Ribosome inactivating proteins (RIPs) such as ricin and abrin depurinate an adenine base in the sarcin/ricin loop in the large ribosomal subunit, leading to inhibtion of protein synthesis and cell death. Here, we demonstrate that RIP toxin activity can be detected via nanopore-based DNA sequencing using synthetic oligonucleotide substrates. This is achieved by monitoring the mismatch proportion at the canonical target sequences incorporated into the synthetic substrate and determining the sequence length distribution throughout the entire substrate sequence. The mismatch proportion increases and sequence length distribution decreases with increasing toxin concentration for both ricin and abrin in buffer as well as in more complex backgrounds such as saliva and nasal secretions.

Turner, Matthew W [Pacific Northwest National Labo↗
DOE OSTI2024

NovaDemux v39.07

This program is a sequence demultiplexer intended primarily for, but not limited to, Illumina sequencing machines. Typically, multiple experiments ("libraries") are pooled together and sequenced at once, with genetic molecules of these libraries tagged with a synthetic DNA "barcode". After sequencing, the data is demultiplexed into one file per library based on the barcode. However, errors in barcode reading cause misassignment and decrease yield. NovaDemux uses advanced statistical methods to maximize yield while minimizing misassignment compared to existing software.

Bushnell, Brian [Lawrence Berkeley National Labora↗
DOE OSTI2024

The interplay of DNA repair context with target sequence predictably biases Cas9-generated mutations

Abstract Repair of double-stranded breaks generated by CRISPR/Cas9 is highly dependent on the flanking DNA sequence. To learn about interactions between DNA repair and target sequence, we measure frequencies of over 236,000 distinct Cas9-generated mutational outcomes at over 2800 synthetic target sequences in 18 DNA repair deficient mouse embryonic stem cells lines. We classify the outcomes in an unbiased way, finding a specialised role forPrkdc(DNA-PKcs protein) andPolmin creating 1 bp insertions matching the nucleotide on the protospacer-adjacent motif side of the break, a variable involvement ofNbnandPolqin the creation of different deletion outcomes, and uni-directional deletions dependent on both end-protection and end-resection. Using our dataset, we build predictive models of the mutagenic outcomes of Cas9 scission that outperform the current standards. This work improves our understanding of DNA repair gene function, and provides avenues for more precise modulation of Cas9-generated mutations.

Science & Technology - Other Topics↗
DOE OSTI2022

synDNA—a Synthetic DNA Spike-in Method for Absolute Quantification of Shotgun Metagenomic Sequencing

The synDNAs designed in this study enable accurate and reproducible measurements of absolute amount and fold changes of bacterial species in complex microbial communities. The method proposed here is versatile and promising as it can be applied to bacterial communities or genomic features like genes and operons, in addition to being easily adaptable by other research groups at a low cost.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2026

SEGUID v2: Extending SEGUID checksums for circular, linear, single- and double-stranded biological sequences

Background Synthetic biology involves combining different DNA fragments, each containing functional biological parts, to address specific problems. Fundamental gene-function research often requires cloning and propagating DNA fragments, such as those from the iGEM Parts Registry or Addgene, typically distributed as circular plasmids. Addgene’s repository alone offers around 150,000 plasmids. To ensure data integrity, cryptographic checksums can be calculated for the sequences. Each sequence has a unique checksum, making checksums useful for validation and quick lookups of associated annotations. For example, the SEGUID checksum uniquely identifies protein sequences with a 27-character string. Objectives The original SEGUID, while effective for protein sequences and single-stranded DNA (ssDNA), is not suitable for circular DNA since there is no natural starting position nor for double-stranded DNA (dsDNA) since two separate sequences are present. Challenges include how to uniquely represent linear dsDNA, circular ssDNA, and circular dsDNA. To meet these needs, we propose SEGUID v2, which extends the original SEGUID to handle additional types of sequences. Conclusions SEGUID v2 produces orientation and rotation invariant checksums for single-stranded, double-stranded, possibly staggered, linear, and circular DNA and RNA sequences. Customizable alphabets allow for other types of sequences. In contrast to the original SEGUID, which uses Base64, SEGUID v2 uses Base64url to encode the SHA-1 hash. This ensures SEGUID v2 checksums can be used as-is in filenames, regardless of platform, and in URLs, with minimal friction. Availability SEGUID v2 is readily available for major programming languages, distributed under the MIT license. JavaScript package seguid is available on npm, Python package seguid on PyPi, R package seguid on CRAN, and a Tcl script on GitHub. These tools, along with documentation, examples, and an online SEGUID Calculator , can be found at https://www.seguid.org .

Pereira, Humberto↗
DOE OSTI2026

DIVA/DeviceEditor v6.1.2

DIVA is an end-to-end DNA design and construction management platform that streamlines how researchers design, build, and receive sequence-verified DNA constructs. Through a web-based BioCAD interface (DeviceEditor), researchers independently design DNA constructs and submit them to a centralized queue with a single action. Designs progress transparently through standardized states which allow researchers to track status and access finished constructs via a central DNA repository. Submitted designs are reviewed by dedicated staff for feasibility and optimization, reducing costly failures and improving downstream execution. Automated DNA assembly software optimizes construction strategies by reusing existing parts where possible and sourcing synthetic DNA only when needed. Standardized, sequence-agnostic assembly methods enable many independent constructs to be built in parallel using lab automation, dramatically increasing throughput. High-throughput next-generation sequencing is used to verify construct accuracy, with flexible platforms selected based on task requirements. Throughout the process, detailed success and failure data are captured and analyzed, enabling continuous improvement of assembly protocols. Compared to traditional, manual DNA construction workflows, DIVA offers higher scalability, transparency, reproducibility, and data-driven optimization.

Plahar, Hector [Lawrence Berkeley National Laborat↗
DOE OSTI2026

Construct design for precise DNA insertion in plants

Precise insertion of DNA sequences at targeted locations in plant genomes is pivotal for synthetic biology, genetics, and crop improvement. Construct design plays a critical role in achieving precise insertions, yet practical guidance remains limited. This review provides an in-depth overview of construct design principles and targeted DNA insertion (knock-in) strategies in plants. We assess the strengths, limitations, and construct requirements of current knock-in methods for specific applications, including short, large, and multifragment insertions. Additionally, we explore the potential of adopting advanced nonplant technologies to enhance knock-in efficiency and precision in plants. This review provides a valuable resource for facilitating the effective application of knock-in technologies to genetically improve crops with minimal off-target effects.

DNA construct↗
DOE OSTI2020

Efficacy and Delivery of Novel FAST Agents for Coronaviruses

We proposed to test and develop advanced delivery for novel agents from our collaborators Facile Accelerated Specific Therapeutics (FAST) platform to reduce coronavirus replication. Sachi Bioworks Inc., Prof. Anushree Chatterjee, and Prof. Prashant Nagpal at the University of Colorado Boulder have developed a bioinformatics and synthesis pipeline to produce sequence specific theranostic agents (agents that can be therapies and/or diagnostics) that are inherently transported into the cytoplasm of mammalian host cells and sequence-specifically interfere in nucleic acid replication. The agent comprises a small nanoparticle (2-5 nm) chosen for ideal cellular transport and/or imaging conjugated to a short, synthetic DNA analog oligomer designed for binding to one or more target viral sequences. The sequence specific binding of the FAST agent to its target prevents nucleic acid replication due to its high affinity binding. While the small nanoparticle facilitates delivery in vitro, we plan to package the FAST agents into a larger nanoparticle (80-300 nm) for future in vivo delivery applications. Our team at Sandia has expertise encapsulating biomolecules including protein, DNA, and RNA into solid lipid nanoparticles (LNP) and lipid coated mesoporous silica nanoparticles (LC-MSN) and shown successful delivery in mouse models to multiple tissues. Our team focused on formulation parameters for FAST agents into lipid nanoparticles (LNP) and lipid coated mesoporous silica nanoparticles (LC-MSN) for enhanced delivery and/or efficacy and in vivo translation. We used lipid formulas that have been shown in literature to facility in vitro and more importantly, in vivo delivery. In our work discussed below, we successfully demonstrate loading and release of FAST agents on silica core and stable LC-MSN in a reasonable size range for in vivo testing.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2020

DISCo-microbe: design of an identifiable synthetic community of microbes

Microbiomes are extremely important for their host organisms, providing many vital functions and extending their hosts’ phenotypes. Natural studies of host-associated microbiomes can be difficult to interpret due to the high complexity of microbial communities, which hinders our ability to track and identify individual members along with the many factors that structure or perturb those communities. For this reason, researchers have turned to synthetic or constructed communities in which the identities of all members are known. However, due to the lack of tracking methods and the difficulty of creating a more diverse and identifiable community that can be distinguished through next-generation sequencing, most such in vivo studies have used only a few strains. To address this issue, we developed DISCo-microbe, a program for the design of an identifiable synthetic community of microbes for use in in vivo experimentation. The program is composed of two modules; (1) create, which allows the user to generate a highly diverse community list from an input DNA sequence alignment using a custom nucleotide distance algorithm, and (2) subsample, which subsamples the community list to either represent a number of grouping variables, including taxonomic proportions, or to reach a user-specified maximum number of community members. As an example, we demonstrate the generation of a synthetic microbial community that can be distinguished through amplicon sequencing. The synthetic microbial community in this example consisted of 2,122 members from a starting DNA sequence alignment of 10,000 16S rRNA sequences from the Ribosomal Database Project. We generated simulated Illumina sequencing data from the constructed community and demonstrate that DISCo-microbe is capable of designing diverse communities with members distinguishable by amplicon sequencing. Using the simulated data we were able to recover sequences from between 97–100% of community members using two different post-processing workflows. Furthermore, 97–99% of sequences were assigned to a community member with zero sequences being misidentified. We then subsampled the community list using taxonomic proportions to mimic a natural plant host–associated microbiome, ultimately yielding a diverse community of 784 members. DISCo-microbe can create a highly diverse community list of microbes that can be distinguished through 16S rRNA gene sequencing, and has the ability to subsample (i.e., design) the community for the desired number of members and taxonomic proportions. Although developed for bacteria, the program allows for any alignment input from any taxonomic group, making it broadly applicable. The software and data are freely available from GitHub and Python Package Index (PYPI).

16S rRNA↗
DOE OSTI2021

Accelerating strain phenotyping with desorption electrospray ionization-imaging mass spectrometry and untargeted analysis of intact microbial colonies

Significance Synthetic biology has entered an era in which reading and writing DNA sequences are no longer rate-limiting steps in microbial strain engineering. Indeed, analytical methods measuring the resulting metabolic outcomes of specific gene edits have lagged behind the ability to generate new recombinant strains. Herein, we report a mass spectrometry strategy to accelerate these analytical workflows by directly analyzing metabolites and molecules produced from engineered microorganisms in a multiplexed process. Using untargeted acquisitions and unsupervised analytics, we assess the molecular features that change across discrete strains including primary target species, secondary products, and species outside the engineered fatty acid biosynthesis pathway.

09 BIOMASS FUELS↗
DOE OSTI2020

Programmable gene regulation for metabolic engineering using decoy transcription factor binding sites

Abstract Transcription factor decoy binding sites are short DNA sequences that can titrate a transcription factor away from its natural binding site, therefore regulating gene expression. In this study, we harness synthetic transcription factor decoy systems to regulate gene expression for metabolic pathways in Escherichia coli. We show that transcription factor decoys can effectively regulate expression of native and heterologous genes. Tunability of the decoy can be engineered via changes in copy number or modifications to the DNA decoy site sequence. Using arginine biosynthesis as a showcase, we observed a 16-fold increase in arginine production when we introduced the decoy system to steer metabolic flux towards increased arginine biosynthesis, with negligible growth differences compared to the wild type strain. The decoy-based production strain retains high genetic integrity; in contrast to a gene knock-out approach where mutations were common, we detected no mutations in the production system using the decoy-based strain. We further show that transcription factor decoys are amenable to multiplexed library screening by demonstrating enhanced tolerance to pinene with a combinatorial decoy library. Our study shows that transcription factor decoy binding sites are a powerful and compact tool for metabolic engineering.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

A standardized quantitative analysis strategy for stable isotope probing metagenomics

ABSTRACT Stable isotope probing (SIP) facilitates culture-independent identification of active microbial populations within complex ecosystems through isotopic enrichment of nucleic acids. Many DNA-SIP studies rely on 16S rRNA gene sequences to identify active taxa, but connecting these sequences to specific bacterial genomes is often challenging. Here, we describe a standardized laboratory and analysis framework to quantify isotopic enrichment on a per-genome basis using shotgun metagenomics instead of 16S rRNA gene sequencing. To develop this framework, we explored various sample processing and analysis approaches using a designed microbiome where the identity of labeled genomes and their level of isotopic enrichment were experimentally controlled. With this ground truth dataset, we empirically assessed the accuracy of different analytical models for identifying active taxa and examined how sequencing depth impacts the detection of isotopically labeled genomes. We also demonstrate that using synthetic DNA internal standards to measure absolute genome abundances in SIP density fractions improves estimates of isotopic enrichment. In addition, our study illustrates the utility of internal standards to reveal anomalies in sample handling that could negatively impact SIP metagenomic analyses if left undetected. Finally, we present SIPmg , an R package to facilitate the estimation of absolute abundances and perform statistical analyses for identifying labeled genomes within SIP metagenomic data. This experimentally validated analysis framework strengthens the foundation of DNA-SIP metagenomics as a tool for accurately measuring the in situ activity of environmental microbial populations and assessing their genomic potential. IMPORTANCE Answering the questions, “who is eating what?” and “who is active?” within complex microbial communities is paramount for our ability to model, predict, and modulate microbiomes for improved human and planetary health. These questions can be pursued using stable isotope probing to track the incorporation of labeled compounds into cellular DNA during microbial growth. However, with traditional stable isotope methods, it is challenging to establish links between an active microorganism’s taxonomic identity and genome composition while providing quantitative estimates of the microorganism’s isotope incorporation rate. Here, we report an experimental and analytical workflow that lays the foundation for improved detection of metabolically active microorganisms and better quantitative estimates of genome-resolved isotope incorporation, which can be used to further refine ecosystem-scale models for carbon and nutrient fluxes within microbiomes.

54 ENVIRONMENTAL SCIENCES↗
DOE OSTI2026

Synthetic overlapping genes stabilize genetic systems

Overlapping genes—wherein two different proteins are translated from alternative reading frames of the same DNA sequence—provide a means to stabilize an engineered gene by directly linking its evolutionary fate with that of an overlapping gene. However, creating overlapping gene pairs is challenging, as it requires redesigning both protein products to accommodate overlap constraints. Here, we present a new “overlapping, alternate-frame insertion” (OAFI) method for creating synthetic overlapping genes by inserting an “inner” gene, encoded in an alternate frame, into a flexible region of an “outer” gene. Using OAFI, we create new overlapping gene pairs of genetic reporters and bacterial toxins within an antibiotic resistance gene. We show that both the inner and outer genes retain function despite redesign, with translation of the inner gene influenced by its overlap position in the outer gene. Importantly, we show that, despite these inner gene sequences not contributing to outer gene function, selection for the outer gene alters the permitted inactivating mutations in the inner gene, and that overlapping toxins can restrict horizontal gene transfer of the antibiotic resistance gene. Overall, OAFI offers a versatile tool for synthetic biology, expanding the applications of overlapping genes in gene stabilization and biocontainment.

Biological and medical sciences↗
DOE OSTI2024

Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

Summary Synthetic promoters may be designed using short cis ‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar ( Populus tremula × Populus alba ), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence ( GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA ) and Syn3‐10b‐2 (3′: GGGCCTGTGG ). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2023

Manipulating the 3D organization of the largest synthetic yeast chromosome

Whether synthetic genomes can power life has attracted broad interest in the synthetic biology field. Here, we report de novo synthesis of the largest eukaryotic chromosome thus far, synIV, a 1,454,621-bp yeast chromosome resulting from extensive genome streamlining and modification. We developed megachunk assembly combined with a hierarchical integration strategy, which significantly increased the accuracy and flexibility of synthetic chromosome construction. Besides the drastic sequence changes, we further manipulated the 3D structure of synIV to explore spatial gene regulation. Surprisingly, we found few gene expression changes, suggesting that positioning inside the yeast nucleoplasm plays a minor role in gene regulation. Lastly, we tethered synIV to the inner nuclear membrane via its hundreds of loxPsym sites and observed transcriptional repression of the entire chromosome, demonstrating chromosome-wide transcription manipulation without changing the DNA sequences. Our manipulation of the spatial structure of synIV sheds light on higher-order architectural design of the synthetic genomes.

59 BASIC BIOLOGICAL SCIENCES↗
DOE OSTI2022

Automated model-predictive design of synthetic promoters to control transcriptional profiles in bacteria

Abstract Transcription rates are regulated by the interactions between RNA polymerase, sigma factor, and promoter DNA sequences in bacteria. However, it remains unclear how non-canonical sequence motifs collectively control transcription rates. Here, we combine massively parallel assays, biophysics, and machine learning to develop a 346-parameter model that predicts site-specific transcription initiation rates for any σ 70 promoter sequence, validated across 22132 bacterial promoters with diverse sequences. We apply the model to predict genetic context effects, design σ 70 promoters with desired transcription rates, and identify undesired promoters inside engineered genetic systems. The model provides a biophysical basis for understanding gene regulation in natural genetic systems and precise transcriptional control for engineering synthetic genetic systems.

42 ENGINEERING↗
DOE OSTI2026

Methods for safely sharing dual-use genetic data

Background: Some genetic data has dual-use potential. Sharing pathogen data has shown tremendous value. For example therapeutic development and lineage tracking during the COVID pandemic. This data sharing is complicated by the fact that these data have the potential to be used for harm. The genome sequence of a pathogen can be used to enable malicious genetic engineering approaches or to recreate the pathogen from synthetic DNA. Standard data security methods can be applied to genetic data, but when data is shared between institutions, ensuring appropriate security can be difficult. Sensitive data that is shared internationally among a wide array of institutions can be especially difficult to control. Methods for securely storing and sharing genetic data with potential for dual-use are needed to mitigate this potential harm.Results: Here we propose new methods that allow genetic data to be shared in a data format that prevents a nefarious actor from accessing sensitive aspects of the data. Our methods obfuscate raw sequence data by pooling reads from different samples. This approach can ensure that data is secure while stored and during electronic transfer. We demonstrate that by pooling raw sequence data from multiple samples of the same organism, the ability to fully reconstruct any individual sample is prevented. In the pooled data, most genomic information remains, but reads or mutations cannot be directly attributed to any individual sample. To further restrict access to information, regions of a genome can be removed from the reads.Conclusion: Our methods obscure genomic information within raw sequence reads. This method can allow genetic data to be stored and shared while preventing a nefarious actor from being able to perfectly reconstruct an organism. Broad-scale sequence information remains, while fine scale details about specific samples are difficult or impossible to reconstruct. Our software is available at https://github.com/Geneinfosec-Inc/ReadMixer.

59 BASIC BIOLOGICAL SCIENCES↗